Posts

Showing posts from May, 2011

Ubuntu Won't Boot after Installation - Ask Ubuntu

title says all. writing phone because incapacitated. tired of using windows 7 thought i'd give linux try. create live usb iso , handy program creates usbs can boot from. launch vm , boot ubuntu. works fine. boot usb on main rig , hit "try ubuntu". works fine. restart comp, in windows. ok, i'm ready make plunge. go install ubuntu, wipe entire 500gb hdd. installation fine, i'm asked reset. reset, , boots usb, ok... restart , go boot menu. usb , cd drive show up. i've tried other instillation options, reinstall, install ubuntu alongside ubuntu, wipe disk , install ubuntu, nothing works. tried multiple times , nothing has worked, on endless loop. do? tried looking solutions on internet nothing has helped. in advance , sorry if dumb question. here boot-repair info: http://paste2.org/lptpkga9 specs: wd blue 500gb sata desktop hard drive amd phenom ii x6 processor 8gb kingston ram amd r7 240 radeon graphics card msi 760gm - p23 (fx) 250 w power su

malware - How to remove gocloudly.com malwaare from firefox on ubuntu 16.04 - Ask Ubuntu

i have ad block plus on firefox, clicking on links, randomly opens new window redirecting web pages strating gocloudly.com. i found it's sort of malware , found instructions remove in windows can't find remove in ubuntu. also if there way remove keeping browser history , settings please tell me. thanks in advance. the first thing you'll want find out if system effecting 1 browser, user account, or device. this, firstly see if device on network seeing issue. if is, have problem on network, see network problem section below. if not, try different browser on computer - if still see issue, you'll want computer problem section. if don't see issue still, try create new user profile - if doesn't show issue, check user profile section. if error show new user profile, check browser installation section. network problem the network compromised. because dns servers using have been changed on network, means whenever request address of given site,

boot - GRUB not detecting Legacy BIOS windows 10 installation even with legacy BIOS Ubuntu 16.04LTS installation - Ask Ubuntu

ok might seem common problem couldn't find answers anywhere specific case. freed , created unallocated space c:\ drive in windows , went well. while installing ubuntu 16.04lts, popup came up(sorry not allowed embed images yet.): popup.jpg it means windows installed in bios mode, , didn't want force install ubuntu in uefi clicking "continue in uefi", clicked "go back" instead. installation loaded while , automatically moved forward next step, assumed it'll continue installation in bios mode, detected freedos(my laptop shippped it, on /dev/sda1), , not windows 10(which on /dev/sda2), , gave me option "install ubuntu alongside freedos" only, not windows10. unfortunately considered grub detect later , chose "something else", created / , swap unallocated space, , installed ubuntu. after installing grub isn't detecting windows 10. i confirmed ubuntu installation legacy bios there's no /sys/firmware/efi directory, shouldn'

16.04 - Numpad special keys are discarded - on my account only - Ask Ubuntu

on laptop, the numpad keys stopped working when numlock on . can input digits, when enable numlock, keys nothing @ (directions, home, end, pgup/down, enter nothing). this happens when working terminal, or gedit, etc. "keyboard layout chart" showing keys press not received @ (when numlock on). the keys work correctly when: i create simple terminal ("xterm" command) i switch 1 of virtual terminals (ctrl+alt+f1) in browser. i created fresh user account, , logged in it i tried usual things found on net: "xev" utility shows keys recognized correctly (i receive kp_home, kp_left, etc) this not related "controlling mouse cursor keypad" issue (i tried option , can enable/disable in addition issue) all leads me believe some x-related input/keyboard filtering/processing configuration blame here , , it's related account only. where else can check what's wrong? are there other files/configurations/tools can check? i had u

Cannot shutdown Ubuntu 16.04.1 & 16.10 (64bit) - Ask Ubuntu

after applying progressive upgrades on kernel (via apt dist-upgrade) system unable turn off after select shutdown. disabling "quiet splash" in grub configuration revealed system freezes after "reboot: power down" message. this problem has been observed on kernels 4.4.0-45, 4.4.0-43 , 4.4.0-38, not on kernel 4.4.0-31 system shuts down normally! the same problem evident using ubuntu 16.10 on live session after trying shut down. system specs: core i5 6600k (skylake), z170 chipset

gui - Point ZENITY to CRONTAB: How to - Ask Ubuntu

i running xubuntu 16.04 (lts) and initial problem was: how set crontab job shutdown computer every 30 minutes; how set graphical warning user computer shutdown; for 1st problem (shutdown 30 minutes) solution easy - searched ask ubuntu , other ubuntu forums , found posts, 1 bellow: how restart every 30 minutes automatically? after reading post , others realized there diferent options set crontab job: system wide cronjob, located @ /etc/crontab user(s) cronjob, can acessed in terminal crontab -e (crontab -e diferent sudo crontab -e, root crontab) so having in mind initial crontab output (using crontab located @ /etc/crontab) */30 * * * * root shutdown -r +2 this output says computer shutdown (command: shutdown) , reboot (-r) every 30 minutes +2 minutes, warning transmited terminal (if terminal/console open). please note solution 1st problem worked, refered in link above ( https://askubuntu.com/questions/243546.. .) have use output */30 * * * * root /sbin/

16.04 - Could anyone help me with mouse speed please? - Ask Ubuntu

my mouse way fast , bugs me. looking solution none of them worked me. "xinput --list --short" output: ⎡ virtual core pointer id=2 [master pointer (3)] ⎜ ↳ virtual core xtest pointer id=4 [slave pointer (2)] ⎜ ↳ etps/2 elantech touchpad id=12 [slave pointer (2)] "xinput --list-props"etps/2 elantech touchpad"" output: device 'etps/2 elantech touchpad': device enabled (139): 1 coordinate transformation matrix (141): 1.000000, 0.000000, 0.000000, 0.000000, 1.000000, 0.000000, 0.000000, 0.000000, 1.000000 libinput tapping enabled (273): 0 libinput tapping enabled default (274): 0 libinput tapping drag enabled (275): 1 libinput tapping drag enabled default (276): 1 libinput tapping drag lock enabled (277): 0 libinput tapping drag lock enabled default (278): 0 libinput accel speed (279): 0.000000 libinput accel speed defau

server - Postfix can send but not recieve mail - Ask Ubuntu

i can send email not recieve postfix, postconf -n output is: address_verify_map = proxy:btree:$data_directory/verify_cache alias_database = hash:/etc/aliases alias_maps = hash:/etc/aliases append_dot_mydomain = no biff = no broken_sasl_auth_clients = yes disable_vrfy_command = yes inet_interfaces = inet_protocols = ipv4 mailbox_size_limit = 0 message_size_limit = 11534336 milter_default_action = accept milter_protocol = 2 mydestination = $myhostname, localhost.$mydomain, localhost, mail.$myhostname, myhostname = n3fs.co mynetworks = 127.0.0.1 142.4.215.80 myorigin = $myhostname non_smtpd_milters = inet:localhost:12301 postscreen_access_list = permit_mynetworks postscreen_bare_newline_action = enforce postscreen_bare_newline_enable = yes postscreen_blacklist_action = enforce postscreen_dnsbl_action = enforce postscreen_dnsbl_sites = zen.spamhaus.org*3 bl.spameatingmonkey.net*2 dnsbl.habl.org bl.spamcop.net dnsbl.sorbs.net postscreen_dnsbl_threshold = 3 postscreen_greet_action = en

lubuntu - How does the size of the persistent file in a live version affect performance? - Ask Ubuntu

having, say, 4gb usb pendrive, if 0.5gb reserved persistent installation, perform better or worst reserving 1, 2 or 3gb? let's assume little space needed, way less 0.5gb. when live version boots, take longer in reading partition (affecting setup time)?, or limited swap memory (affecting run time)? in particular, i'm dealing lubuntu 16.04 live version computers limited resources (~1gb ram), , have installed gnu octave, occupying 300mb of persistent memory. persistence space on usb stick used store information, information still there after reboot. size won't affect performance. having more space allow have more information, including files, available between boots.

Internet problems with Netgear WNA3100 - Ask Ubuntu

every time try connect internet using netgear wna3100 adapter, once enter in password says wpa incompatible static wep keys . ideas on how fix it? enter wireless router's administration web page using web browser , going http://192.168.0.1 (or http://192.168.1.1 ). use administrator's login name , password log in. find wireless security tab, , indicates enryption set wep. change setting wpa2 , or wpa2-aes . there may setting in same area indicates tkip or aes. make sure it's set aes . there's password field need make sure known you. should able connect using netgear wireless adapter.

16.04 - Virtualbox cannot create .COM object - Ask Ubuntu

after rebooting of ubuntu 16.04, can no longer launch virtualbox. errors out following error message: failed create virtualboxclient com object. application terminate. document empty. location: '/home/al/.config/virtualbox/virtualbox.xml', line 1 (0), column 1. /build/virtualbox-xs7cr9/virtualbox-5.0.24-dfsg/src/vbox/main/src-server/virtualboximpl.cpp[534] (nsresult virtualbox::init()). result code: ns_error_failure (0x80004005) component: virtualboxwrap interface: ivirtualbox {0169423f-46b4-cde9-91af-1e9d5b6cd945} i've tried virtualbox support, need go through ubuntu support. (discussion follows) virtualbox support is document empty? contents of /home/al/.config/virtualbox/virtualbox.xml ? did host recently, such create new user account? my response the .vbox file empty. windows 10 session, name of .vbox file. there windows 10.vbox-prev file, have xml code. tried renaming empty file, , copying prev file windows 10.vbox. when try run it, same e

firefox - Ensure hardware acceleration feature working - Ask Ubuntu

firefox in ubuntu distribution typically takes high resources of cpu. since hardware acceleration suggested way ensure performance, have enabled under browser preference, say. however, not getting sense of cpu being relieved spikes of resource consumption. so, how may monitor gpu enabled hardware acceleration working via top or ps command. , how optimize use of gpu in browsing?

xorg - Xubuntu starts normally on google chrome but not on team viewer - Ask Ubuntu

i have remote computer xubuntu 14.04.05 installed, fine 1 day stopped working, used minning, has 6 gpu, of them working fine. after day ask has access computer restart it, see on team viewer computer online tried connect there black screen indicating log file google chrome, installed, went google chrome , can connect , open normal desktop screen can start mining... says doesn´t have gpu installed... other mining computers have same installation , configuration on team viewer can start miners fine, not on chrome... first know if there way fix computer remotely... , second if possible start miners on google chrome. it has installed google chrome, team viewer, fglrx-updates , amd-sdk3.0, apart apps comes normal installation. thank you i found out deleting xorg.conf file can see screen on team viewer looks password changes... not sure why...

command line - bash syntax error near token `fi' - Ask Ubuntu

when open terminal, following 2 lines bash: /home/kyle/.bashrc: line 119: syntax error near unexpected token `fi' bash: /home/kyle/.bashrc: line 119: `fi' i don't know why started or if it's normal. causes syntax error , how fix it? when open new terminal window system starts new instance of shell. in case bash (bourne again shell) when bash starts reads bunch of startup scripts configure various things prompt, colors, etc. 1 of these scripts file .bashrc in home directory. more info on check what .bashrc file , do? more info on bash scripting: https://help.ubuntu.com/community/beginners/bashscripting in case file has been edited , not valid bash script. therefore error message line 119: syntax error near unexpected token... that why steeldriver asked post content of file see wrong it. that file optional. if want rename else - .bashrc.old example , open new window. error messages gone prompts, colous , other shell customisations gone to

12.04 - playonlinux is unable to find 32bits / 64bits OpenGL library - Ask Ubuntu

Image
when open fresh instalation of playonlinux, gives 2 dialog box mentioned in title: playonlinux unable find 32bits opengl library playonlinux unable find 64bits opengl library i using ubuntu 12.04 ( and new it ) , know how solve problem edit terminal output ~$ playonlinux [main] message: playonlinux (4.1.8) starting [clean_tmp] message: cleaning temp directory xlib: extension "glx" missing on display ":0". xlib: extension "glx" missing on display ":0". [check_opengl] warning: xlib: extension "glx" missing on display ":0". xlib: extension "glx" missing on display ":0". [check_opengl] warning: [main] message: filesystem compatible [install_plugins] message: checking plugin: capture... [maj_check] message: web version : 1349866727 [maj_check] message: current local version : 1349563245 [maj_check] message: updating list [install_plugins] message: checking plugin: screencap... [install_p

Display stuck on 640x480 - Ask Ubuntu

i have old hp proliant. i've got dual-boot setup windows 7. windows 7 tells me i've got generic non-pnp monitor on standard vga graphics adapter, , display settings set 1024x768, looks nice. i've tried xubuntu , lubuntu, can't change monitor settings: it's stuck on 640x480 , large fit on screen. i've tried nomodeset in grub settings didn't help. i've seen several pieces of advice here, seem deal nvidia adapters. can do? can't use machine this! xrandr: failed size of gamma output default screen 0: minimum 640 x 480, current 640 x 480, maximum 640 x 480 default connected 640x480+0+0 0mm x 0mm 640x480 73.00* lspci 00:00.0 host bridge: intel corporation e7220/e7221 memory controller hub (rev 05) 00:01.0 pci bridge: intel corporation e7220/e7221 pci express root port (rev 05) 00:1c.0 pci bridge: intel corporation 82801fb/fbm/fr/fw/frw (ich6 family) pci express port 1 (rev 03) 00:1d.0 usb controller: intel corporation 82801fb/fbm/fr/fw

ubuntu USB drive dead?? no light, no feedback - Ask Ubuntu

i had ubuntu 16.04.1 lts installed , booted lexar 128gb usb 3.0 on laptop without hard drive. using it, worked fine restarted pc. after see caps lock light blinking , on screen there orange brown background (it ubuntu background) there horizontal lines this: ██████████████████████████████████████████ █████████████████████████████████████████████████████ █████████████████████████████████████████████████ ███████████████████████████████████████████████████████ and usb drive dead. dead... no light, no feedback connected, not saying drive not supported or needs formating, nothing... tried connect mac , there nothing, doesn't show in disk utility. have 4gb usb there live ubuntu(its not installed bootable ubuntu usb can try , install ubuntu other disk) , in there nothing. did ubuntu kill usb drive .-. ?? 4gb usb, opened "try without installing" , in there tried boot-repair thingy doesn't detect. remember, there no light coming usb or happens when connect mac or broke

software sources - Error with installation of ROS - Ask Ubuntu

as install ros, comes error: ignoring file 'ros-latest-list' in directory '/etc/apt/sources.list.d/' has no filename extension. should file 'ros-latest-list'? from man sources.list : filenames [in /etc/apt/sources.list.d/] need have either extension .list or .sources depending on contained format. so suggest renaming it: sudo mv ros-latest-list ros-latest.list

Canclled/deleted download keeps resuming in Chrome - Ask Ubuntu

i'm using chrome version 54.0.2840.71 (64-bit) / elementary os loki (16.04). reason download keeps resuming after cancellation, deletion, restart, system restart, etc. it's not malware--libreoffice tar main site. any thoughts? thanks.

When will the Ubuntu 16.10 for ARM be released? - Ask Ubuntu

i found ubuntu server 16.10 has been released, , how ubuntu 16.10 arm? thanks. ubuntu 16.10 has been released. packages build armhf , arm64 in archive. there however, no generic images can installed on arm device. in order install on arm device, custom images specific device must built, in order boot properly. there arm64 server iso , raspberry pi 2 image available, however.

How to recover deleted "dpkg" directory? - Ask Ubuntu

unfortunately i've deleted dpkg directory while removing lock. mistake typed root@sam:~$ rm -r /var/lib/dpkg now when trying install/uninstall packages shows me following error. e: not open lock file /var/lib/dpkg/lock - open (2: no such file or directory) what should now? root + rm + -r = disaster so did condemn perdition? ls -l /var/lib/dpkg/ total 9964 drwxr-xr-x 2 root root 4096 nov 28 11:18 alternatives -rw-r--r-- 1 root root 11 sep 18 14:08 arch -rw-r--r-- 1 root root 2573807 nov 28 11:18 available -rw-r--r-- 1 root root 2561322 nov 28 10:25 available-old -rw-r--r-- 1 root root 8 abr 24 2013 cmethopt -rw-r--r-- 1 root root 538 sep 25 17:24 diversions -rw-r--r-- 1 root root 457 sep 25 17:24 diversions-old drwxr-xr-x 2 root root 483328 nov 28 11:17 info -rw-r----- 1 root root 0 nov 28 11:18 lock drwxr-xr-x 2 root root 4096 mar 22 2013 parts -rw-r--r-- 1 root root 135 abr 24 2013 statoverride -rw-r--r-- 1 root ro

command line - Difference between cd / and cd ~ - Ask Ubuntu

could give me explanation of difference between cd / , cd ~ also, difference when using same command @ administrator level? cd / changes directory root of filesystem, / while cd ~ changes home directory. here ~ interpreted home folder of user executing command. me /home/anwar . if run cd ~ root, change working directory root users home, @ /root . root users home folder not typically reside under /home/ directory, instead found directly under root directory / . check question general introduction linux filesystem how understand ubuntu file system layout?

system installation - Installing 16.04 on iMac 17,1 5k - Ask Ubuntu

i can't life of me boot. i've have drive partitioned, , 16.04 installed correctly usb stick. had set acpi=off , nomodeset install work. but after install, same grub params, ubuntu not boot. blank purple window. i've tried lots of variations, 1915.modeset=0 , radeon.modeset=0 , etc.... nothing. has got ubuntu installed on 1 of new 5k imacs? i've tried 14.04, 16.04, , ubuntu 16.10. has graphics system. not sure why works fine during install, not after install.

Ubuntu 16.04: Sound and video problems - Ask Ubuntu

Image
i updated ubuntu 16.04 while ago , haven't gotten sound work ever since. oddly enough, there's sound when start computer, none afterwards. there no sound output devices detected: in addition, @ point, volume indicator disappeared task bar, , there's no check box in sound settings put back. when run aplay -i , nothing appears. @ 1 point, tried suggested in this article on unixmen.com , including unmuting in alsamixer , reinstalling alsa , pulseaudio , , updating sound drivers (although i'm really, worried might have made problem worse), , got sound work while, when restarted later, stopped working again. how can fix this? please let me know if there's other information can provide - problem has been plaguing me past few months. the command display soundcards aplay -l not aplay -i as there sound @ startup , try disable speech-dispatcher running sudo update-rc.d -f speech-dispatcher remove , reboot if no luck, disable pulseaudio testing,

16.04 - Job for fail2ban.service failed because the control process exited with error code - Ask Ubuntu

i have installed fail2ban on server (os: ubuntu 16.0.4 lts). when try start it, following error message: job fail2ban.service failed because control process exited error code. here outputs various diagnostic commands: morpheous@zeus:~$ sudo systemctl status fail2ban.service ● fail2ban.service - fail2ban service loaded: loaded (/lib/systemd/system/fail2ban.service; enabled; vendor preset: enabled) active: inactive (dead) (result: exit-code) since sat 2016-10-29 11:46:36 utc; 18s ago docs: man:fail2ban(1) process: 23122 execstart=/usr/bin/fail2ban-client -x start (code=exited, status=255) oct 29 11:46:36 zeus systemd[1]: fail2ban.service: unit entered failed state. oct 29 11:46:36 zeus systemd[1]: fail2ban.service: failed result 'exit-code'. oct 29 11:46:36 zeus systemd[1]: fail2ban.service: service hold-off time over, scheduling restart. oct 29 11:46:36 zeus systemd[1]: stopped fail2ban service. oct 29 11:46:36 zeus systemd[1]: fail2ban.service: start req

16.04 on Lenovo, screen doesn't come on after suspend - Ask Ubuntu

a couple days ago upgraded 14.04 16.04 on lenovo z50-75. when close lid, suspends , powers down correctly; when open lid, can hear hard disk spin up, screen never comes on, , wind having power off. won't come suspend 16.04 lts , xubuntu 16.04.1 won't wake correctly after opening lid seemed similar, followed instructions on linux daddy here , running 4.4.25 kernel, didn't help. manually running sudo pm-suspend --quirk-dpms-on has same effect: machine powers down; pressing space or whatever causes spin up, screen never turns on. i see other answers talk editing /etc/systemd/logind.conf ; haven't changed in there (as problem on resume, not suspend). in file commented out. i see my lenovo z40 can't recover sleep/suspend mode 16.04 on lenovo z40 (similar think z50), , 1 answer there mentions nvidia driver. however, lshw , lspci commands used here figure out nvidia card model don't nvidia card; amd radeon. this page on help.ubuntu.com talks e

apt - Sub-process /usr/bin/dpkg returned an error code (1) ? - Ask Ubuntu

i trying install hide.me vpn reason. unfortunately keep running same error every time. i'm using these instructions to install it. below error keep running into. nate1141@natespc:~$ sudo apt-get install openvpn network-manager-openvpn network-manager-openvpn-gnome [sudo] password nate1141: reading package lists... done building dependency tree reading state information... done openvpn newest version (2.3.10-1ubuntu2). network-manager-openvpn newest version (1.1.93-1ubuntu1). network-manager-openvpn-gnome newest version (1.1.93-1ubuntu1). 0 upgraded, 0 newly installed, 0 remove , 83 not upgraded. 1 not installed or removed. after operation, 0 b of additional disk space used. want continue? [y/n] y setting jdk1.8.0-111 (1.8.0111-fcs-1) ... unpacking jar files... tools.jar... error: not open input file: /usr/java/jdk1.8.0_111/lib/tools.pack plugin.jar... error: not open input file: /usr/java/jdk1.8.0_111/jre/lib/plugin.pack javaws.jar... error: not open input

crash - Ubuntu 16.10 overheating problem - Ask Ubuntu

i installed ubuntu 16.10 , since ubuntu reboots itself. output of: last | grep "oct 31" is: aegefel tty7 :0 mon oct 31 15:15 gone - no logout reboot system boot 4.8.0-26-generic mon oct 31 15:14 still running aegefel tty7 :0 mon oct 31 15:02 - down (00:04) reboot system boot 4.8.0-26-generic mon oct 31 15:02 - 15:06 (00:04) aegefel tty7 :0 mon oct 31 14:33 - crash (00:28) reboot system boot 4.8.0-26-generic mon oct 31 14:33 - 15:06 (00:33) aegefel tty7 :0 mon oct 31 14:12 - crash (00:20) reboot system boot 4.8.0-26-generic mon oct 31 14:12 - 15:06 (00:54) aegefel tty7 :0 mon oct 31 13:08 - crash (01:04) reboot system boot 4.8.0-26-generic mon oct 31 13:08 - 15:06 (01:58) which leads me believr it's caused crash i don't know cause happened when tried see movie or when did backup how should proceed? edit 1 the c

bash - Script for finding a longest and shortest word or string in a file? - Ask Ubuntu

i performing genomics. have file fasta format reads. these genes. each gene called read or contig. each contig starts header , followed alphabets or nusleotides eg: actg , of specific length. want determine longest contig , shortest contig or read or gene in file. please tell me ubuntu script find such contigs. each contig or read in fasta format follows: >locus_1000_transcript_1/1_confidence_0.000_length_648 ftbs=645 (header) ccgccttggtaacctcgccagcatattgagctttggatccggatggtcgtagaatggcaag gcaggagagagtgtctaatgtggcgccgctctgtacccggggggtaacaatgaatttgcga cgacgtggtatgcccttcgttgaaacccttattagttggagccgctatgtggcggtccaat tatcaagtatttcccacatcttgaagcgcttctggatgtacgcatactatgggttgacgtt agtgtagccgagatttcacagtagctccgaacggtggtagcagacgcccgttcacaaaaac the header has defined format shows gene loci , number of genes , there space between each contig or read. each of read or contig in file start header of same type mentioned above, values may differ. each contig or read starts > sign. there may

networking - Network not working and bad archive mirror - Ask Ubuntu

i trying create liveusb running ubuntu server, , having trouble wireless adapter. have wireless adapter in place, , during boot, server never asks me network, , tries auto config immediately. never works. dhcp error. i try skip it, gets stuck @ bad archive mirror. help?

command line - What is the name of the executable that launches the Unity app drawer / menu? - Ask Ubuntu

i run xpra start :100 --start-child= now, run 'xterm', far better if run unity app drawer or "start menu" or similar graphically display icons , launch things firefox, terminal, etc click. name of executable can pass present graphical menu?

16.04 - This command can only be used by root - Ask Ubuntu

i'm on ubuntu 16 , i'd add neo4j package. tried in 3 ways leading same error. these attempts: wget -o - http://debian.neo4j.org/neotechnology.gpg.key | apt-key add - sudo wget -o - http://debian.neo4j.org/neotechnology.gpg.key | apt-key add - sudo -i wget -o - http://debian.neo4j.org/neotechnology.gpg.key | apt-key add - but error message: error: command can used root. --2016-11-04 http://debian.neo4j.org/neotechnology.gpg.key resolving debian.neo4j.org (debian.neo4j.org)... 52.0.233.188 connecting debian.neo4j.org (debian.neo4j.org)|52.0.233.188|:80... connected. http request sent, awaiting response... 200 ok length: 4791 (4,7k) [application/octet-stream] saving to: ‘stdout’ - 0%[ ] 0 --.-kb/s in 0s cannot write ‘-’ (broken pipe). you need change wget command from: sudo wget -o - http://debian.neo4j.org/neotechnology.gpg.key | apt-key add - to: sudo wget http://debian.neo4j.org/neotechnolog

boot - Missing Operating System on USB drive - Ask Ubuntu

this question has answer here: how install ubuntu usb key? (without using startup disk creator) 17 answers i'm trying install minimal ubuntu installation on usb drive (complete install, not live boot). after installation, however, when try boot usb, "missing operating system". i think there might problem grub , don't know how fix it. i've done install usb before messed main grub file, don't want that. this output of fdisk -l pertaining usb drive: disk /dev/sdc: 4027 mb, 4027580416 bytes 124 heads, 62 sectors/track, 1023 cylinders, total 7866368 sectors units = sectors of 1 * 512 = 512 bytes sector size (logical/physical): 512 bytes / 512 bytes i/o size (minimum/optimal): 512 bytes / 512 bytes disk identifier: 0x73a571aa device boot start end blocks id system /dev/sdc1 2048 7616511 3807232

networking - Ubuntu 16.04 Connects to Ethernet and Wifi but no Internet - Ask Ubuntu

as title says, cannot connect new ubuntu computer internet means. not sure if dealing 3 independent problems here, or if more fundamental preventing me accessing internet. appreciated. ethernet ubuntu connects (slowly) router when connected directly cable. there other computers on network know not router. router not register new computer, , don't ipv4 address, , there no data transfer. i've tried disabling ipv6 , nothing. wifi as before there other computers on wifi network. i've tried (ralink rt2760) wifi card in ubuntu computer , works fine, not that. ubuntu connects wifi after few minutes there no data transfer, , doesn't connect @ all. have tried disabling ipv6 , makes no difference. have tried booting disk new computer on old computer new wifi card, , wifi works, know drivers ok. bonus: tethering through mobile i can connect other ubuntu computers tethering them through android phone. doesn't work on new computer since either crashes phone, or e

Firefox Ubuntu 16.10 not loading any google domains - Ask Ubuntu

i have started having trouble none of google domain sites load. @ gmail.com loading bar hangs half way. if load, waiting plus.google or hangouts.google. have refreshed firefox defaults. have no extensions installed @ all. removed firefox using software store , reinstalled. firefox browse of choice , working for months. in last 2 weeks have use chrome google related sites , searches ( real drag ). have searched far , wide, information find few years old , none of s linux. i5-2520m 4gb ram ubuntu 16.10 64-bit kernel 4.8.5 gnome desktop environment firefox 49.0.2

package management - Missing dependency 'libtag1c2a' when installing Musique 1.4 on Ubuntu 16.10 (Yakkety Yak) - Ask Ubuntu

i made fresh install of ubuntu 16.10 (64bits) , i'm trying reinstall packages, including musique 1.4 deb 64bits package, worked fine on previous system (16.10, 64bits ), got dependency error libtag1c2a . sudo dpkg -i musique64.deb >> musique depends on libtag1c2a; however: >> package libtag1c2a not installed i tried install libgtag1c2a apt , failed, package not available. suggested remplacement packages ( libtag1v5-vanilla:i386 libtag1v5:i386 libtag1v5-vanilla libtag1v5 ) doesn't make work either. i found similar topic here , same bug reported in developer web site [edit] solution tried: install musique 32bits deb package install musique 1.1 apt, works it's big regression install libtag1c2a trusty package : conflict libtag1v5 sudo dpkg --force-depends -i package.deb all right, well, since has come this... try this package (same packaging official ubuntu yakkety package, 1.4 source). for paranoid (or want build 32 bits packa

networking - Internet Suddenly Stopped Working - Ask Ubuntu

i'm running 16.04 on laptop , says i'm connected whenever pull webpage says dns address not found try checking proxy, firewall, , dns configuration it working fine couple of days ago. this happens on firefox , chrome. this not happen if boot live copy of ubuntu on same laptop , connect same network. i've tried deleting , re-adding network in edit connections problem persists. additional info: this wifi connection in system settings -> network -> network proxy says method: none nslookup google.com returned connection timed out ping 8.8.8.8 had 0% packet loss ifconfig -a enp0s25 link encap:ethernet hwaddr b8:6b:23:b7:8b:1e broadcast multicast mtu:1500 metric:1 rx packets:0 errors:0 dropped:0 overruns:0 frame:0 tx packets:0 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 rx bytes:0 (0.0 b) tx bytes:0 (0.0 b) interrupt:20 memory:e4400000-e4420000 lo

dependencies - Broken packages error when installing libdvd-pkg - Ask Ubuntu

this question has answer here: unable correct problems, have held broken packages 5 answers i'm new linux , trying add dvd playback. keep getting broken packages error. i'm running 16.04 lts. screenshot try sudo apt-get -f install and if doesn't work, install synaptic , try repair broken packages it.

suspend - Ubuntu 16.10 won't wake up after suspending - Ask Ubuntu

i updated 16.10, after suspending computer, can't seem manage wake again, screen black , nothing happens after quick press power button or other button matter. thing seems work hard reboot. read somewhere suspending , hibernating might hardware problem, able suspend before 16.10, seems me problem lies in latest update. (never tried hibernating before update, doesn't work, might hardware issue instead , i'm not concerned atm.) another similar question earlier version problem asked pm-suspend.log, sudo lspci -vnn | grep -a12 vga" , "cat /proc/cmdline" , i'm going attach these here well. pm-suspend.log: http://paste.ubuntu.com/23441649/ ## sudo lspci -vnn | grep -a12 vga: ## 00:02.0 vga compatible controller [0300]: intel corporation 2nd generation >core processor family integrated graphics controller [8086:0126] (rev 09) >(prog-if 00 [vga controller]) subsystem: asustek computer inc. 2nd generation core processor family >integrated

grub2 - How do I reset a lost password (using recovery mode requires me to type the password)? - Ask Ubuntu

Image
i need reset password. have followed these steps: how reset lost administrative password? however, go "root" or "netroot" recovery options, tells me: give root password maintenance (or type control-d continue) clearly, not know root password. if type control-d, return list of options. this page read: under chapter 'the other way': 4. highlight line begins kernel , press 'e' edit` but in grub configuration file have no line starts kernel . only: setparams 'ubuntu...' recordfail set gxfpayload... insmod part_msdos insmod ext2 set root=... search --no-floppy... linux /boot/vmlinuz-2.6.38... initrd /boot/initrd.img-2.6.... those lines in grub. line should edit? or there way reset password? since cannot access recovery mode , you'll have change password accessing installed ubuntu system live cd/dvd or live usb system . follows detailed walkthrough on how that. this easiest if can use ubuntu system (e

dual boot - How to make dualboot (2 linux distros) - Ask Ubuntu

can give me step-by-step guidance how can install on laptop(that has 1 hard drive) 2 linux distros(kali linux , lubuntu 16.04)? i'm stuck partitioning. how should separate drive? purpose give kali linux 50 gb of space , rest lubuntu. suppose see grub on boot, can select os launch. in case not separately looking separate harddisk partition folders under linux distribution (for eg: separate partition /home /usr /etc). assuming aware how install linux , using gparted etc. install first os suppose kali. in partition details window select manual. create 3 partitions 50 gb ext4 kali (here set mount pint '/' without quotes, keep aside 4 gb swap, format third partition whatever space left ext4. install , boot kali. verify kali works , have 3 partitions. now next os, in similar fashion insert bootable usb or disc lubuntu, @ partition prompt choose manual. select third partition, , set mount point / (this root linux/unix). no need touch other partition. continue sett